v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila mojavensis Dmo-Mir-970_3p (mature (guide)) URS00000384A0_7230

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Drosophila mojavensis. Annotated by 1 database (MirGeneDB). Found in the Drosophila mojavensis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UCAUAAGACACACGCGGCUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Aedes aegypti (yellow fever mosquito) aae-miR-970
    2. Anopheles gambiae aga-miR-970
    3. Bactrocera dorsalis bdo-miR-970
    4. Cochliomyia hominivorax mature cho-miR-970
    5. Cochliomyia macellaria mature cma-miR-970
    6. Culex quinquefasciatus cqu-miR-970
    7. Drosophila ananassae Dan-Mir-970_3p (mature (guide))
    8. Drosophila melanogaster dme-miR-970-3p
    9. Drosophila pseudoobscura dps-miR-970-3p
    10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0331101_df_nrg
    11. Drosophila simulans dsi-miR-970-3p
    12. Drosophila virilis dvi-miR-970-3p
    13. Drosophila yakuba Dya-Mir-970_3p (mature (guide))
    14. Tribolium castaneum tca-miR-970-3p