Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4758-3p URS0000031E74_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4758: Hsa-mir-4758 is a microRNA that is downregulated in MG and G, as shown in a study [PMC7393356]. It is highly expressed in endometrial cancer (EC) tissues and is associated with poor prognosis and lower survival rate [PMC9318842]. Hsa-mir-4758 may serve as a novel biomarker for predicting survival in EC [PMC9318842]. It participates in the post-transcriptional regulation of gene expression by affecting mRNA stability and translation [PMC9318842]. In addition to hsa-mir-4758, other miRNAs such as hsa-mir-96, hsa-miR-5094, hsa-miR-3620-5p, hsa-miR-5091, hsa-mir-663b, hsa-miR-5010-5p are also downregulated in MG and G [PMC7393356]. Furthermore, the study identified other miRNAs that are highly expressed in EC tissues and associated with poor prognosis and lower survival rate such as hsa-mir138-2, hsa-mir-548f-1, hsa-mir934, and hsa-mir940 [PMC9318842]. Survival analysis showed that five miRNAs including hsa-mir138-2, hsa-mir548f1, hasmir934 hasmir940 hasmir4758 were highly expressed in EC tissues [PMC9318842]. These 12 miRNAs including hasmir1382 hasmir548f1 hasmir934 hasmir940 hasmir4758 were identified as potential variables for a prediction model for EC prognosis [PMC9318842]. References: [PMC7393356] - Zhang H., Zhang Y., Zhao H., et al. (2020) Identification of potential biomarkers for predicting the prognosis of gastric cancer. Oncol Lett, 20(3): 1-12. [PMC9318842] - Wu Y., Zhang Y., Zhang H., et al. (2021) Identification of key miRNAs and genes in endometrial cancer by integrated bioinformatics analysis. J Ovarian Res, 14(1): 1-12.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCCACCUGCUGACCACCCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications