Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries let-7c stem-loop (oar-let-7c) URS0000031E12_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-let-7c: Oar-let-7c, a member of the let-7 family of miRNAs, has been identified in sheep milk extracellular vesicles (EVs) [PMC7070426]. These EVs contain several let-7 family miRNAs, including oar-let-7c [PMC7070426]. In a study, it was found that 14 sheep miRNAs in the top 20, accounting for about 98%, were immune-related, and oar-let-7c was among them [PMC7070426]. The accuracy of the sequencing results for oar-let-7c was verified using real-time quantitative PCR [PMC7070426]. The EDEM1 gene was found to regulate oar-let-7c along with other let-7 family members [PMC9656243]. Additionally, oar-miR99a, oar-miR125b, and oar-miR143 were also present in the study, along with oar-miR10a and oar-miR200b [PMC8872417]. In another study comparing fine wool sheep and Liaoning cashmere goats, oar-miR143 and oar-let-7c were reported to be highly abundant in both groups [PMC8872417]. Interestingly, these miRNAs have also been associated with differing curliness in the hair follicles of Hu sheep and Chinese tan sheep [PMC8872417].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications