Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens let-7c stem-loop (hsa-let-7c) URS0000031E12_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-let-7c: Hsa-let-7c is a microRNA that has been studied in relation to osteo/odontogenic markers. The mRNA expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments were conducted using TaqMan® micro-RNA assays on fetal and adult eye samples. The targeted micro-RNAs in these experiments included hsa-let-7c, among others, which showed collagen specificity [PMC3804513]. However, no correlation was observed between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405]. In summary, the expression levels of hsa-let-7c and several osteo/odontogenic markers were detected using specific primer sets [PMC5938007]. Subsequent validation experiments on fetal and adult eye samples showed collagen specificity for hsa-let-7c [PMC3804513]. However, no correlation was found between the expression level of hsa-let-7c and PGC, hsa_circ_000483, or hsa_circ_0001324 [PMC8176405].

MIRLET7C: MIRLET7C is a microRNA (miRNA) that is involved in cell growth and the regulation of the proto-oncogene MYC [PMC7016963]. It is transcribed as part of a polycistronic primary transcript that also produces three intronic miRNAs: MIR99A, MIR125B2, and LET7C [PMC7457246]. MIRLET7C is targeted by several miRNAs, including members of the let-7 family, suggesting potential auto-regulation [PMC7961530]. It has been found to be differentially regulated between transgenic and wild-type mice, indicating divergent regulation of rodent and human PPAR-α [PMC7016963]. In a murine model of abdominal aortic aneurysm (AAA), the expression of MIRLET7C was significantly down-regulated [PMC8740683]. In human AAA patients, MIRLET7C was also found to be significantly down-regulated compared to controls [PMC8740683]. Additionally, MIRLET7C has been implicated in spermatogenesis [PMC6024298]. It has been identified as a tumor suppressor gene that inhibits cancer cell proliferation in normal cells [PMC6566633]. Methylation changes in the promoter region of MIRLET7C have been associated with its expression levels [PMC9847511]. Overall, these findings highlight the diverse roles and regulatory mechanisms associated with MIRLET7C.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications