Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptomyces bingchenggensis 5S rRNA secondary structure diagram

Streptomyces bingchenggensis 5S rRNA URS0000030628_379067

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCGGUGGUCAUUGCGUUAGGGAAACGCCCGGUUACAUUCCGAACCCGGAAGCUAAGCCUUUCAGCGCCGAUGGUACUGCAGGGGGGACUCUGUGGGAGAGUAGGACGCCGCCGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Streptomyces bingchenggensis BCW-1 5S ribosomal RNA
  2. Streptomyces malaysiensis 5S ribosomal RNA
  3. Streptomyces sp. SCA4-21 5S ribosomal RNA
  4. Streptomyces sp. SID6648 5S ribosomal RNA
  5. Streptomyces violaceoruber 5S ribosomal RNA
2D structure