Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Sus scrofa (PDB 3J7Q, chain 7) secondary structure diagram

5S ribosomal RNA from Sus scrofa (PDB 3J7Q, chain 7) URS000002B0D5_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Oryctolagus cuniculus 5S ribosomal RNA from Oryctolagus cuniculus (PDB 6ZVK, chain d2)
  2. Bos taurus 5S rRNA
  3. Homo sapiens 5S rRNA
  4. Mus musculus 5S rRNA
2D structure Publications