Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryzias latipes (Japanese medaka) ola-miR-184-3p URS0000029225_8090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryzias latipes. Annotated by 2 databases (miRBase, RefSeq). Oryzias latipes (Japanese medaka) ola-miR-184-3p sequence is a product of miR-184, ola-miR-184-3p, miR-184-3p, ola-miR-184, mir184-1, mir184-2 genes. Found in the Oryzias latipes reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGACGGAGAACUGAUAAGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Anopheles gambiae aga-miR-184
    2. Branchiostoma floridae bfl-miR-184-3p
    3. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-2314
    4. Gadus morhua gmo-miR-184-3p
    5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-184b
    6. Maylandia zebra mze-miR-184b
    7. Mus musculus Mus_musculus piRNA piR-mmu-8284712
    8. Neolamprologus brichardi nbr-miR-184b
    9. Oreochromis niloticus oni-miR-184b
    10. Pundamilia nyererei pny-miR-184b
    11. Python bivittatus (Burmese python) pbv-miR-184-3p
    12. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63139
    13. Takifugu rubripes fru-miR-184
    14. Tetraodon nigroviridis tni-miR-184
    15. Xenopus laevis (African clawed frog) xla-miR-184