Oryzias latipes (Japanese medaka) ola-miR-184-3p URS0000029225_8090

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 15 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGGACGGAGAACUGAUAAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Anopheles gambiae (African malaria mosquito) aga-miR-184
2. Branchiostoma floridae bfl-miR-184-3p
3. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-2314
4. Gadus morhua (Atlantic cod) gmo-miR-184-3p
5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-184b
6. Maylandia zebra (zebra mbuna) mze-miR-184b
7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8284712
8. Neolamprologus brichardi nbr-miR-184b
9. Oreochromis niloticus oni-miR-184b
10. Pundamilia nyererei pny-miR-184b
11. Python bivittatus pbv-miR-184-3p
12. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63139
13. Takifugu rubripes fru-miR-184
14. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-184
15. Xenopus laevis xla-miR-184

Download

• FASTA
• JSON