Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi nbr-miR-184b URS0000029225_32507

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Anopheles gambiae (African malaria mosquito) aga-miR-184
  2. Branchiostoma floridae bfl-miR-184-3p
  3. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-2314
  4. Gadus morhua (Atlantic cod) gmo-miR-184-3p
  5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-184b
  6. Maylandia zebra (zebra mbuna) mze-miR-184b
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8284712
  8. Oreochromis niloticus oni-miR-184b
  9. Oryzias latipes ola-miR-184-3p
  10. Pundamilia nyererei pny-miR-184b
  11. Python bivittatus pbv-miR-184-3p
  12. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63139
  13. Takifugu rubripes fru-miR-184
  14. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-184
  15. Xenopus laevis xla-miR-184