Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-184b URS0000029225_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Anopheles gambiae aga-miR-184
  2. Branchiostoma floridae (Florida lancelet) bfl-miR-184-3p
  3. Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-2314
  4. Gadus morhua gmo-miR-184-3p
  5. Haplochromis burtoni abu-miR-184b
  6. Maylandia zebra mze-miR-184b
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8284712
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-184b
  9. Oreochromis niloticus oni-miR-184b
  10. Oryzias latipes ola-miR-184-3p
  11. Python bivittatus (Burmese python) pbv-miR-184-3p
  12. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63139
  13. Takifugu rubripes fru-miR-184
  14. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-184
  15. Xenopus laevis (African clawed frog) xla-miR-184