Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-203-3p URS0000028BBC_59729

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Taeniopygia guttata. Annotated by 3 databases (RefSeq, miRBase, MirGeneDB). Taeniopygia guttata (zebra finch) tgu-miR-203-3p sequence is a product of tgu-miR-203, miR-203-3p, tgu-miR-203-3p, MIR203, miR-203 genes. Found in the zebra finch reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGAAAUGUUUAGGACCACUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-203-v1_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-203-3p
    3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
    4. Chrysemys picta bellii Cpi-Mir-203-v1_3p (mature (guide))
    5. Cyprinus carpio ccr-miR-203a
    6. Danio rerio (zebrafish) dre-miR-203a-3p
    7. Gadus morhua gmo-miR-203a-3p
    8. Gallus gallus (chicken) gga-miR-203a
    9. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
    10. Haplochromis burtoni abu-miR-203
    11. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
    12. Lepisosteus oculatus (spotted gar) Loc-Mir-203-v1_3p (mature (guide))
    13. Maylandia zebra (zebra mbuna) mze-miR-203
    14. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
    15. Monodelphis domestica mdo-miR-203
    16. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
    17. Neolamprologus brichardi nbr-miR-203
    18. Ophiophagus hannah (king cobra) oha-miR-203-3p
    19. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
    20. Oryzias latipes (Japanese medaka) ola-miR-203
    21. Paralichthys olivaceus pol-miR-203-3p
    22. Petromyzon marinus pma-miR-203b-3p
    23. Python bivittatus pbv-miR-203-3p
    24. Salmo salar ssa-miR-203a-3p
    25. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
    26. Sphenodon punctatus (tuatara) Spt-Mir-203_3p (mature (guide))
    27. Takifugu rubripes fru-miR-203
    28. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
    29. Tor tambroides (Thai mahseer) miR-203a-3p
    30. Xenopus laevis xla-miR-203-3p
    31. Xenopus tropicalis (tropical clawed frog) xtr-miR-203
    Publications New