Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide)) URS0000028BBC_1415580

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGAAAUGUUUAGGACCACUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
    2. Anolis carolinensis aca-miR-203-3p
    3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
    4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
    5. Cyprinus carpio (common carp) ccr-miR-203a
    6. Danio rerio (zebrafish) dre-miR-203a-3p
    7. Gadus morhua (Atlantic cod) gmo-miR-203a-3p
    8. Gallus gallus (chicken) gga-miR-203a
    9. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
    11. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
    12. Lepisosteus oculatus Loc-Mir-203-v1_3p (mature (guide))
    13. Maylandia zebra mze-miR-203
    14. Monodelphis domestica mdo-miR-203
    15. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
    16. Neolamprologus brichardi nbr-miR-203
    17. Ophiophagus hannah oha-miR-203-3p
    18. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
    19. Oryzias latipes (Japanese medaka) ola-miR-203
    20. Paralichthys olivaceus (Japanese flounder) pol-miR-203-3p
    21. Petromyzon marinus pma-miR-203b-3p
    22. Python bivittatus (Burmese python) pbv-miR-203-3p
    23. Salmo salar (Atlantic salmon) ssa-miR-203a-3p
    24. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
    25. Sphenodon punctatus Spt-Mir-203_3p (mature (guide))
    26. Taeniopygia guttata tgu-miR-203-3p
    27. Takifugu rubripes fru-miR-203
    28. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
    29. Tor tambroides miR-203a-3p
    30. Xenopus laevis (African clawed frog) xla-miR-203-3p
    31. Xenopus tropicalis (tropical clawed frog) xtr-miR-203