Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bibersteinia trehalosi USDA-ARS-USMARC-188 5S ribosomal RNA secondary structure diagram

Bibersteinia trehalosi USDA-ARS-USMARC-188 5S ribosomal RNA URS0000026E11_1263829

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUGUCCAUAGUGCUGUGGUACCACCUGACCCCAUACCGAACUCAGAAGUGAAACGCAGUAACGCCGAUGGUAGUGUGGGGUUUCCCCAUGUGAGAGUAGGGCAACAUCAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Bibersteinia trehalosi 5S ribosomal RNA
  2. Bibersteinia trehalosi USDA-ARS-USMARC-189 5S ribosomal RNA
  3. Bibersteinia trehalosi USDA-ARS-USMARC-190 5S ribosomal RNA
  4. Bibersteinia trehalosi USDA-ARS-USMARC-192 5S ribosomal RNA
2D structure