Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cochliomyia hominivorax (primary screw-worm) mature cho-miR-305-5p URS0000025D76_115425

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Cochliomyia hominivorax. Annotated by 1 database (ENA). Described in 1 paper.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUUGUACUUCAUCAGGUGCUCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Anopheles gambiae (African malaria mosquito) aga-miR-305
    2. Apis mellifera ame-miR-305-5p
    3. Bombyx mori (domestic silkworm) bmo-miR-305-5p
    4. Cochliomyia macellaria mature cma-miR-305-5p
    5. Drosophila ananassae dan-miR-305
    6. Drosophila erecta der-miR-305
    7. Drosophila grimshawi dgr-miR-305
    8. Drosophila melanogaster (fruit fly) dme-miR-305-5p
    9. Drosophila mojavensis dmo-miR-305
    10. Drosophila persimilis dpe-miR-305
    11. Drosophila pseudoobscura dps-miR-305
    12. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294449_df_nrg
    13. Drosophila sechellia dse-miR-305
    14. Drosophila simulans miRNA FBtr0296028_df_nrg
    15. Drosophila willistoni dwi-miR-305
    16. Drosophila yakuba dya-miR-305
    17. Nasonia giraulti ngi-miR-305
    18. Nasonia longicornis nlo-miR-305
    19. Nasonia vitripennis (jewel wasp) nvi-miR-305