Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-338 URS00000254A6_8364

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus tropicalis. Annotated by 3 databases (miRBase, RefSeq, PirBase). Described in 2 papers. Xenopus tropicalis (tropical clawed frog) xtr-miR-338 sequence is a product of xtr-miR-338, mir338-1, mir338-2, miR-338 genes. Found in the tropical clawed frog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCAGCAUCAGUGAUUUUGUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 191 other species

    1. Alligator mississippiensis (American alligator) ami-miR-338-3p
    2. Callorhinchus milii (elephant shark) eshark_mir-338_1
    3. Cyprinus carpio ccr-miR-338
    4. Danio rerio (zebrafish) dre-miR-338
    5. Equus caballus eca-miR-338-3p
    6. Gadus morhua gmo-miR-338-3p
    7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-338
    8. Homo sapiens (human) hsa-miR-338-3p
    9. Ictalurus punctatus (channel catfish) ipu-miR-338
    10. Macaca mulatta mml-miR-338-3p
    11. Maylandia zebra (zebra mbuna) mze-miR-338
    12. Mus musculus mmu-miR-338-3p
    13. Neolamprologus brichardi nbr-miR-338
    14. Oreochromis niloticus (Nile tilapia) oni-miR-338
    15. Pan troglodytes ptr-miR-338
    16. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
    17. Pundamilia nyererei pny-miR-338
    18. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63002
    19. Salmo salar (Atlantic salmon) ssa-miR-338a-3p
    20. Sarcophilus harrisii (Tasmanian devil) sha-miR-338
    21. Sus scrofa ssc-miR-338
    22. Taeniopygia guttata (zebra finch) tgu-miR-338-3p
    23. Takifugu rubripes (torafugu) fru-miR-338
    24. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-338
    25. Tor tambroides miR-338
    26. Xenopus laevis xla-miR-338
    Publications New