Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-338-3p URS00000254A6_59729

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Taeniopygia guttata. Annotated by 2 databases (RefSeq, miRBase). Described in 4 papers. Taeniopygia guttata (zebra finch) tgu-miR-338-3p sequence is a product of miR-338, tgu-miR-338-3p, MIR338, miR-338-3p, tgu-miR-338 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCAGCAUCAGUGAUUUUGUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 69 other species

    1. Alligator mississippiensis ami-miR-338-3p
    2. Callorhinchus milii (elephant shark) eshark_mir-338_1
    3. Cyprinus carpio ccr-miR-338
    4. Danio rerio (zebrafish) dre-miR-338
    5. Equus caballus (horse) eca-miR-338-3p
    6. Gadus morhua gmo-miR-338-3p
    7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-338
    8. Homo sapiens hsa-miR-338-3p
    9. Ictalurus punctatus (channel catfish) ipu-miR-338
    10. Macaca mulatta mml-miR-338-3p
    11. Maylandia zebra mze-miR-338
    12. Mus musculus (house mouse) mmu-miR-338-3p
    13. Neolamprologus brichardi nbr-miR-338
    14. Oreochromis niloticus oni-miR-338
    15. Pan troglodytes (chimpanzee) ptr-miR-338
    16. Pongo pygmaeus ppy-miR-338-3p
    17. Pundamilia nyererei pny-miR-338
    18. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63002
    19. Salmo salar (Atlantic salmon) ssa-miR-338a-3p
    20. Sarcophilus harrisii sha-miR-338
    21. Sus scrofa ssc-miR-338
    22. Takifugu rubripes (torafugu) fru-miR-338
    23. Tetraodon nigroviridis tni-miR-338
    24. Tor tambroides miR-338
    25. Xenopus laevis (African clawed frog) xla-miR-338
    26. Xenopus tropicalis xtr-miR-338