Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) secondary structure diagram

Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) URS0000023412_9669

Automated summary: This tRNA sequence is 73 nucleotides long and is found in Mustela putorius furo. Annotated by 2 databases (GtRNAdb, Rfam). Described in 5 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) sequence is a product of tRNA-Thr-TGT-1-1 gene. Found in the Mustela putorius furo reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCUCCAUAGCUCAGUGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCGAUCCUCGCUGGGGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 135 other species

    1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    2. Alligator mississippiensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    3. Alosa alosa tRNA-Thr
    4. Amazona aestiva (blue-fronted amazon) tRNA
    5. Ameiurus melas (black bullhead) tRNA-Thr
    6. Anas platyrhynchos tRNA
    7. Anguilla anguilla tRNA-Thr
    8. Anolis carolinensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    9. Apaloderma vittatum tRNA
    10. Astyanax mexicanus tRNA
    11. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    12. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    13. Callipepla squamata tRNA
    14. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    15. Callorhinchus milii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    16. Calypte anna (Anna's hummingbird) tRNA
    17. Camelus ferus tRNA
    18. Canis lupus familiaris tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    19. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    20. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    21. Chaetura pelagica tRNA
    22. Charadrius vociferus tRNA
    23. Chelonia mydas (green seaturtle) tRNA
    24. Chelydra serpentina (Common snapping turtle) tRNA-Thr
    25. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    26. Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    27. Chrysemys picta bellii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    28. Colinus virginianus tRNA
    29. Colius striatus (speckled mousebird) tRNA
    30. Columba livia tRNA
    31. Cuculus canorus tRNA
    32. Danionella translucida tRNA-Thr
    33. Danio rerio tRNA-Thr (TGT) (tRNA-Thr-TGT-8 1 to 6)
    34. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    35. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    36. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    37. Ficedula albicollis tRNA
    38. Gallus gallus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    39. Gasterosteus aculeatus (three-spined stickleback) tRNA
    40. Geospiza fortis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    41. Hippoglossus stenolepis (Pacific halibut) tRNA-Thr
    42. Homo sapiens tRNA-Thr (anticodon TGT) 2-1 (TRT-TGT2-1)
    43. Lamprotornis superbus tRNA-OTHER
    44. Larimichthys crocea tRNA
    45. Latimeria chalumnae tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    46. Lepisosteus oculatus (spotted gar) tRNA
    47. Lonchura striata domestica (Bengalese finch) tRNA
    48. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    49. Manacus vitellinus (golden-collared manakin) tRNA
    50. Megalops atlanticus (tarpon) tRNA-Thr
    51. Meleagris gallopavo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    52. Melopsittacus undulatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    53. Mesitornis unicolor (brown roatelo) tRNA
    54. Monodelphis domestica tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    55. Myotis brandtii tRNA
    56. Myotis davidii tRNA
    57. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    58. Nipponia nippon (crested ibis) tRNA
    59. Notamacropus eugenii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    60. Nothobranchius furzeri tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    61. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    62. Oreochromis niloticus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-2-2)
    63. Ornithorhynchus anatinus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    64. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    65. Oryzias latipes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    66. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    67. Ovis aries tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    68. Pangasianodon hypophthalmus tRNA-Thr
    69. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    70. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    71. Patagioenas fasciata monilis tRNA
    72. Pelecanus crispus tRNA
    73. Pelodiscus sinensis tRNA
    74. Perca flavescens tRNA-Thr
    75. Perca fluviatilis (European perch) tRNA-Thr
    76. Dryobates pubescens tRNA
    77. Poecilia formosa tRNA
    78. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
    79. Pterocles gutturalis tRNA
    80. Pteropus alecto (black flying fox) tRNA
    81. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    82. Sarcophilus harrisii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    83. Scleropages formosus tRNA
    84. Struthio camelus australis tRNA
    85. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    86. Taeniopygia guttata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    87. Takifugu rubripes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    88. Tetraodon nigroviridis tRNA
    89. Tinamus guttatus tRNA
    90. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    91. Vicugna pacos tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    92. Xiphophorus maculatus (southern platyfish) tRNA
    2D structure