Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) secondary structure diagram

Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1) URS0000023412_9358

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGCUCCAUAGCUCAGUGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCGAUCCUCGCUGGGGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 98 other species

    1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    2. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
    3. Albula goreensis tRNA-Thr
    4. Alligator mississippiensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    5. Alosa alosa tRNA-Thr
    6. Amazona aestiva tRNA
    7. Ameiurus melas (black bullhead) tRNA-Thr
    8. Anas platyrhynchos tRNA
    9. Anguilla anguilla (European eel) tRNA-Thr
    10. Anolis carolinensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    11. Apaloderma vittatum tRNA
    12. Astyanax mexicanus (Mexican tetra) tRNA
    13. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    14. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    15. Callipepla squamata (scaled quail) tRNA
    16. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    17. Callorhinchus milii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    18. Calypte anna tRNA
    19. Camelus ferus (Wild Bactrian camel) tRNA
    20. Canis lupus familiaris tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    21. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    22. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    23. Chaetura pelagica (chimney swift) tRNA
    24. Charadrius vociferus tRNA
    25. Chelonia mydas (green seaturtle) tRNA
    26. Chelydra serpentina (Common snapping turtle) tRNA-Thr
    27. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    28. Chrysemys picta bellii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    29. Colinus virginianus (northern bobwhite) tRNA
    30. Colius striatus (speckled mousebird) tRNA
    31. Columba livia tRNA
    32. Cuculus canorus (common cuckoo) tRNA
    33. Danionella translucida tRNA-Thr
    34. Danio rerio tRNA-Thr (TGT) (tRNA-Thr-TGT-8 1 to 6)
    35. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    36. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    37. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    38. Ficedula albicollis tRNA
    39. Gallus gallus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    40. Gasterosteus aculeatus tRNA
    41. Geospiza fortis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    42. Hippoglossus stenolepis tRNA-Thr
    43. Homo sapiens tRNA-Thr (anticodon TGT) 2-1 (TRT-TGT2-1)
    44. Lamprotornis superbus tRNA-OTHER
    45. Larimichthys crocea tRNA
    46. Latimeria chalumnae tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    47. Lepisosteus oculatus tRNA
    48. Lonchura striata domestica (Bengalese finch) tRNA
    49. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    50. Manacus vitellinus (golden-collared manakin) tRNA
    51. Megalops atlanticus tRNA-Thr
    52. Meleagris gallopavo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    53. Melopsittacus undulatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    54. Mesitornis unicolor tRNA
    55. Monodelphis domestica tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    56. Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    57. Myotis brandtii tRNA
    58. Myotis davidii tRNA
    59. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    60. Nipponia nippon tRNA
    61. Notamacropus eugenii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    62. Nothobranchius furzeri tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    63. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    64. Oreochromis niloticus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-2-2)
    65. Ornithorhynchus anatinus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    66. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    67. Oryzias latipes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    68. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    69. Ovis aries tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    70. Pangasianodon gigas (Mekong giant catfish) tRNA-Thr
    71. Pangasianodon hypophthalmus tRNA-Thr
    72. Pangasius djambal tRNA-Thr
    73. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    74. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    75. Patagioenas fasciata monilis tRNA
    76. Pelecanus crispus tRNA
    77. Pelodiscus sinensis tRNA
    78. Perca flavescens (yellow perch) tRNA-Thr
    79. Perca fluviatilis (European perch) tRNA-Thr
    80. Phrynosoma platyrhinos tRNA-OTHER
    81. Dryobates pubescens tRNA
    82. Pleuronectes platessa (European plaice) tRNA-Thr
    83. Poecilia formosa tRNA
    84. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
    85. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
    86. Pteropus alecto tRNA
    87. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    88. Sarcophilus harrisii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    89. Scleropages formosus tRNA
    90. Struthio camelus australis tRNA
    91. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    92. Taeniopygia guttata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    93. Takifugu rubripes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    94. Tetraodon nigroviridis tRNA
    95. Tinamus guttatus tRNA
    96. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    97. Vicugna pacos tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    98. Xiphophorus maculatus tRNA
    99. Podarcis lilfordi None
    2D structure