Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Alosa alosa (allis shad) tRNA-Thr secondary structure diagram

Alosa alosa (allis shad) tRNA-Thr URS0000023412_278164

Automated summary: This tRNA sequence is 73 nucleotides long and is found in Alosa alosa. Annotated by 1 database (ENA). Described in 0 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCUCCAUAGCUCAGUGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCGAUCCUCGCUGGGGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 129 other species

    1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    2. Alligator mississippiensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    3. Amazona aestiva tRNA
    4. Ameiurus melas tRNA-Thr
    5. Anas platyrhynchos tRNA
    6. Anguilla anguilla tRNA-Thr
    7. Anolis carolinensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    8. Apaloderma vittatum tRNA
    9. Astyanax mexicanus tRNA
    10. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    11. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    12. Callipepla squamata tRNA
    13. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    14. Callorhinchus milii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    15. Calypte anna tRNA
    16. Camelus ferus tRNA
    17. Canis lupus familiaris tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    18. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    19. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    20. Chaetura pelagica tRNA
    21. Charadrius vociferus tRNA
    22. Chelonia mydas tRNA
    23. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    24. Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    25. Chrysemys picta bellii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    26. Colinus virginianus tRNA
    27. Colius striatus tRNA
    28. Columba livia tRNA
    29. Cuculus canorus tRNA
    30. Danionella translucida tRNA-Thr
    31. Danio rerio tRNA-Thr (TGT) (tRNA-Thr-TGT-8 1 to 6)
    32. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    33. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    34. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    35. Ficedula albicollis tRNA
    36. Gallus gallus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    37. Gasterosteus aculeatus tRNA
    38. Geospiza fortis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    39. Hippoglossus stenolepis (Pacific halibut) tRNA-Thr
    40. Homo sapiens tRNA-Thr (anticodon TGT) 2-1
    41. Lamprotornis superbus tRNA-OTHER
    42. Larimichthys crocea tRNA
    43. Latimeria chalumnae tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    44. Lepisosteus oculatus tRNA
    45. Lonchura striata domestica tRNA
    46. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    47. Manacus vitellinus tRNA
    48. Megalops atlanticus tRNA-Thr
    49. Meleagris gallopavo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    50. Melopsittacus undulatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    51. Mesitornis unicolor tRNA
    52. Monodelphis domestica tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    53. Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    54. Myotis brandtii tRNA
    55. Myotis davidii tRNA
    56. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    57. Nipponia nippon tRNA
    58. Notamacropus eugenii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    59. Nothobranchius furzeri tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    60. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
    61. Oreochromis niloticus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-2-2)
    62. Ornithorhynchus anatinus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    63. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    64. Oryzias latipes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    65. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    66. Ovis aries tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    67. Pangasianodon hypophthalmus tRNA-Thr
    68. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    69. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    70. Patagioenas fasciata monilis tRNA
    71. Pelecanus crispus tRNA
    72. Pelodiscus sinensis tRNA
    73. Perca flavescens tRNA-Thr
    74. Perca fluviatilis tRNA-Thr
    75. Dryobates pubescens tRNA
    76. Poecilia formosa tRNA
    77. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
    78. Pterocles gutturalis tRNA
    79. Pteropus alecto tRNA
    80. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    81. Sarcophilus harrisii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    82. Scleropages formosus tRNA
    83. Struthio camelus australis tRNA
    84. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    85. Taeniopygia guttata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
    86. Takifugu rubripes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    87. Tetraodon nigroviridis tRNA
    88. Tinamus guttatus tRNA
    89. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
    90. Vicugna pacos tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
    91. Xiphophorus maculatus tRNA
    2D structure New