Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pangasius djambal tRNA-Thr secondary structure diagram

Pangasius djambal tRNA-Thr URS0000023412_1691987

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCCAUAGCUCAGUGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCGAUCCUCGCUGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 100 other species

  1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  2. Albula glossodonta tRNA-OTHER
  3. Albula goreensis tRNA-Thr
  4. Alligator mississippiensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  5. Alosa alosa tRNA-Thr
  6. Amazona aestiva tRNA
  7. Ameiurus melas (black bullhead) tRNA-Thr
  8. Anas platyrhynchos tRNA
  9. Anguilla anguilla tRNA-Thr
  10. Anolis carolinensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  11. Apaloderma vittatum tRNA
  12. Astyanax mexicanus (Mexican tetra) tRNA
  13. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  14. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  15. Callipepla squamata tRNA
  16. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  17. Callorhinchus milii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  18. Calypte anna (Anna's hummingbird) tRNA
  19. Camelus ferus tRNA
  20. Canis lupus familiaris tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  21. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  22. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  23. Chaetura pelagica (chimney swift) tRNA
  24. Characodon lateralis tRNA-Thr
  25. Charadrius vociferus tRNA
  26. Chelonia mydas (green seaturtle) tRNA
  27. Chelydra serpentina tRNA-Thr
  28. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  29. Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  30. Chrysemys picta bellii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  31. Colinus virginianus tRNA
  32. Colius striatus (speckled mousebird) tRNA
  33. Columba livia tRNA
  34. Cuculus canorus tRNA
  35. Danionella translucida tRNA-Thr
  36. Danio rerio tRNA-Thr (TGT) (tRNA-Thr-TGT-8 1 to 6)
  37. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  38. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  39. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  40. Ficedula albicollis tRNA
  41. Gallus gallus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  42. Gasterosteus aculeatus (three-spined stickleback) tRNA
  43. Geospiza fortis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  44. Hippoglossus stenolepis tRNA-Thr
  45. Homo sapiens tRNA-Thr (anticodon TGT) 2-1 (TRT-TGT2-1)
  46. Lamprotornis superbus tRNA-OTHER
  47. Larimichthys crocea tRNA
  48. Latimeria chalumnae tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  49. Lepisosteus oculatus tRNA
  50. Lonchura striata domestica (Bengalese finch) tRNA
  51. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  52. Manacus vitellinus (golden-collared manakin) tRNA
  53. Megalops atlanticus tRNA-Thr
  54. Meleagris gallopavo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  55. Melopsittacus undulatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  56. Mesitornis unicolor (brown roatelo) tRNA
  57. Monodelphis domestica tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  58. Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  59. Myotis brandtii tRNA
  60. Myotis davidii tRNA
  61. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  62. Nipponia nippon (crested ibis) tRNA
  63. Notamacropus eugenii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  64. Nothobranchius furzeri tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  65. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  66. Oreochromis niloticus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-2-2)
  67. Ornithorhynchus anatinus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  68. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  69. Oryzias latipes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  70. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  71. Ovis aries tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  72. Pangasianodon gigas tRNA-Thr
  73. Pangasianodon hypophthalmus tRNA-Thr
  74. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  75. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  76. Patagioenas fasciata monilis tRNA
  77. Pelecanus crispus tRNA
  78. Pelodiscus sinensis tRNA
  79. Perca flavescens tRNA-Thr
  80. Perca fluviatilis tRNA-Thr
  81. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  82. Dryobates pubescens tRNA
  83. Pleuronectes platessa (European plaice) tRNA-Thr
  84. Podarcis lilfordi tRNA.Thr
  85. Poecilia formosa tRNA
  86. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  87. Pterocles gutturalis tRNA
  88. Pteropus alecto tRNA
  89. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  90. Sarcophilus harrisii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  91. Scleropages formosus (Asian bonytongue) tRNA
  92. Struthio camelus australis tRNA
  93. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  94. Taeniopygia guttata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  95. Takifugu rubripes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  96. Tetraodon nigroviridis tRNA
  97. Tinamus guttatus tRNA
  98. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  99. Vicugna pacos tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  100. Xiphophorus maculatus tRNA
2D structure