Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Albula glossodonta (roundjaw bonefish) tRNA-OTHER secondary structure diagram

Albula glossodonta (roundjaw bonefish) tRNA-OTHER URS0000023412_121402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCCAUAGCUCAGUGGUUAGAGCACUGGUCUUGUAAACCAGGGGUCGCGAGUUCGAUCCUCGCUGGGGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 99 other species

  1. Ailuropoda melanoleuca tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  2. Albula goreensis tRNA-Thr
  3. Alligator mississippiensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  4. Alosa alosa (allis shad) tRNA-Thr
  5. Amazona aestiva (blue-fronted amazon) tRNA
  6. Ameiurus melas (black bullhead) tRNA-Thr
  7. Anas platyrhynchos tRNA
  8. Anguilla anguilla tRNA-Thr
  9. Anolis carolinensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  10. Apaloderma vittatum tRNA
  11. Astyanax mexicanus (Mexican tetra) tRNA
  12. Balaenoptera acutorostrata scammoni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  13. Bos taurus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  14. Callipepla squamata (scaled quail) tRNA
  15. Callithrix jacchus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  16. Callorhinchus milii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  17. Calypte anna (Anna's hummingbird) tRNA
  18. Camelus ferus (Wild Bactrian camel) tRNA
  19. Canis lupus familiaris tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  20. Carlito syrichta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  21. Ceratotherium simum simum tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  22. Chaetura pelagica tRNA
  23. Charadrius vociferus tRNA
  24. Chelonia mydas (green seaturtle) tRNA
  25. Chelydra serpentina (Common snapping turtle) tRNA-Thr
  26. Chlorocebus sabaeus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  27. Choloepus hoffmanni tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  28. Chrysemys picta bellii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  29. Colinus virginianus (northern bobwhite) tRNA
  30. Colius striatus tRNA
  31. Columba livia tRNA
  32. Cuculus canorus tRNA
  33. Danionella translucida tRNA-Thr
  34. Danio rerio tRNA-Thr (TGT) (tRNA-Thr-TGT-8 1 to 6)
  35. Dasypus novemcinctus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  36. Equus caballus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  37. Felis catus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  38. Ficedula albicollis tRNA
  39. Gallus gallus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  40. Gasterosteus aculeatus tRNA
  41. Geospiza fortis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  42. Hippoglossus stenolepis tRNA-Thr
  43. Homo sapiens tRNA-Thr (anticodon TGT) 2-1 (TRT-TGT2-1)
  44. Lamprotornis superbus tRNA-OTHER
  45. Larimichthys crocea tRNA
  46. Latimeria chalumnae tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  47. Lepisosteus oculatus tRNA
  48. Lonchura striata domestica (Bengalese finch) tRNA
  49. Macaca mulatta tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  50. Manacus vitellinus (golden-collared manakin) tRNA
  51. Megalops atlanticus (tarpon) tRNA-Thr
  52. Meleagris gallopavo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  53. Melopsittacus undulatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  54. Mesitornis unicolor tRNA
  55. Monodelphis domestica tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  56. Mustela putorius furo tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  57. Myotis brandtii tRNA
  58. Myotis davidii tRNA
  59. Myotis lucifugus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  60. Nipponia nippon (crested ibis) tRNA
  61. Notamacropus eugenii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  62. Nothobranchius furzeri tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  63. Ochotona princeps tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1)
  64. Oreochromis niloticus tRNA-Thr (TGT) (tRNA-Thr-TGT-2-1, tRNA-Thr-TGT-2-2)
  65. Ornithorhynchus anatinus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  66. Oryctolagus cuniculus tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  67. Oryzias latipes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  68. Otolemur garnettii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  69. Ovis aries tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  70. Pangasianodon gigas (Mekong giant catfish) tRNA-Thr
  71. Pangasianodon hypophthalmus tRNA-Thr
  72. Pangasius djambal tRNA-Thr
  73. Pan troglodytes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  74. Papio anubis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  75. Patagioenas fasciata monilis tRNA
  76. Pelecanus crispus tRNA
  77. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  78. Perca flavescens tRNA-Thr
  79. Perca fluviatilis tRNA-Thr
  80. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  81. Dryobates pubescens tRNA
  82. Pleuronectes platessa (European plaice) tRNA-Thr
  83. Podarcis lilfordi tRNA.Thr
  84. Poecilia formosa tRNA
  85. Pongo abelii tRNA-Thr (TGT) (tRNA-Thr-TGT-5-1)
  86. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  87. Pteropus alecto tRNA
  88. Saimiri boliviensis boliviensis tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  89. Sarcophilus harrisii tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  90. Scleropages formosus (Asian bonytongue) tRNA
  91. Struthio camelus australis tRNA
  92. Sus scrofa tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  93. Taeniopygia guttata tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1, tRNA-Thr-TGT-1-2)
  94. Takifugu rubripes tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  95. Tetraodon nigroviridis tRNA
  96. Tinamus guttatus tRNA
  97. Tursiops truncatus tRNA-Thr (TGT) (tRNA-Thr-TGT-1-1)
  98. Vicugna pacos tRNA-Thr (TGT) (tRNA-Thr-TGT-3-1)
  99. Xiphophorus maculatus (southern platyfish) tRNA
2D structure