Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Stenotrophomonas sp. YR399 5S ribosomal RNA secondary structure diagram

Stenotrophomonas sp. YR399 5S ribosomal RNA URS00000222C5_1884371

Automated summary: This rRNA sequence is 115 nucleotides long and is found in Stenotrophomonas sp. YR399. Annotated by 1 database (ENA). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCUGGUGAAAUUAGCGCUAUGGAACCACCCGAUCCCAUCCCGAACUCGGAAGUGAAACGUAGCUGCGCCGAUGGUAGUGUGGCCUAAGCCAUGCGAGAGUAGGUCAUCGCCAGGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. bacterium AM6 5S ribosomal RNA
    2. Parastrongyloides trichosuri 5S ribosomal RNA
    3. Pseudomonas sp. 5S ribosomal RNA
    4. Stenotrophomonas indicatrix 5S rRNA. Bacterial TSU
    5. Stenotrophomonas lactitubi 5S rRNA. Bacterial TSU
    6. Stenotrophomonas maltophilia 5BA-I-2 5S ribosomal RNA
    7. Stenotrophomonas maltophilia 5S ribosomal RNA
    8. Stenotrophomonas maltophilia R551-3 5S ribosomal RNA
    9. Stenotrophomonas sp. Br8 5S ribosomal RNA
    10. Stenotrophomonas sp. DR822 5S ribosomal RNA
    11. Stenotrophomonas sp. MYb57 5S ribosomal RNA
    12. Stenotrophomonas sp. NA06056 5S ribosomal RNA
    13. Stenotrophomonas sp. PA-6-5C 5S ribosomal RNA
    14. Stenotrophomonas sp. SbOxS2 5S ribosomal RNA
    15. Stenotrophomonas sp. TEPEL 5S ribosomal RNA
    2D structure