Capra hircus (goat) chi-miR-1296 URS000002103A_9925

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 16 other species
• 9 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAGGGCCCUGGCUCCAUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

1. Bos taurus bta-miR-1296
2. Callithrix jacchus cja-miR-1296
3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
4. Cavia porcellus (domestic guinea pig) cpo-miR-1296-5p
5. Dasypus novemcinctus dno-miR-1296-5p
6. Echinops telfairi Ete-Mir-1296_5p (mature (guide))
7. Equus caballus (horse) eca-miR-1296
8. Gorilla gorilla gorilla ggo-miR-1296 (MIR1296)
9. Gorilla gorilla (western gorilla) ggo-miR-1296
10. Homo sapiens hsa-miR-1296-5p
11. Nomascus leucogenys nle-miR-1296
12. Oryctolagus cuniculus ocu-miR-1296-5p
13. Otolemur garnettii oga-miR-1296
14. Pan troglodytes ptr-miR-1296
15. Pongo pygmaeus ppy-miR-1296
16. Sus scrofa (pig) ssc-miR-1296-5p

Publications Download

• FASTA
• JSON