Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-1296 URS000002103A_9593

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gorilla gorilla. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Gorilla gorilla (western gorilla) ggo-miR-1296 sequence is a product of miR-1296, ggo-miR-1296, MIR1296 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAGGGCCCUGGCUCCAUCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Bos taurus (cattle) bta-miR-1296
    2. Callithrix jacchus cja-miR-1296
    3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
    4. Capra hircus chi-miR-1296
    5. Cavia porcellus (domestic guinea pig) cpo-miR-1296-5p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1296-5p
    7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-1296_5p (mature (guide))
    8. Equus caballus (horse) eca-miR-1296
    9. Homo sapiens hsa-miR-1296-5p
    10. Nomascus leucogenys nle-miR-1296
    11. Oryctolagus cuniculus (rabbit) ocu-miR-1296-5p
    12. Otolemur garnettii oga-miR-1296
    13. Pan troglodytes (chimpanzee) ptr-miR-1296
    14. Pongo pygmaeus ppy-miR-1296
    15. Sus scrofa ssc-miR-1296-5p