Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 12 (SNORA12) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 12 (SNORA12) URS000002084A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA12: SNORA12 is a type of H/ACA box small nucleolar RNA that has been studied in the context of infection and autoimmune diseases [PMC4080608]. In a study involving asthmatics, it was found that the expression of SNORA12 gene was significantly increased during infection [PMC4080608]. Additionally, in a small Taiwanese cohort study focused on systemic lupus erythematosus (SLE), it was observed that the expression of SNORA12 was decreased in T cells [PMC8834103]. These findings suggest that SNORA12 may play a role in immune responses and disease pathogenesis [PMC4080608] [PMC8834103]. However, further research is needed to fully understand the specific mechanisms and functions of SNORA12 in these contexts [PMC4080608] [PMC8834103].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUGUGGUGGUUUUCUUUUUGGCACAUUUGUUAAGUUUUCAAAUGGGCCUAACUCUGCCACAUAUAUAAUAUCGGAGAUGGCAAAGGCUUGUGACGGAGAUAUCUCUCUUAAGCCUUUCCUGCAUCAGAGAAUGGCUCCCACAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications