Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Erwinia billingiae Eb661 5S ribosomal RNA secondary structure diagram

Erwinia billingiae Eb661 5S ribosomal RNA URS000001FB40_634500

Automated summary: This rRNA sequence is 120 nucleotides long and is found in Erwinia billingiae Eb661. Annotated by 1 database (RefSeq). Described in 2 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCCUGGCGGCUUUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Enterobacter asburiae 5S ribosomal RNA
    2. Enterobacter cloacae 5S rRNA
    3. Enterobacter cloacae EcWSU1 5S ribosomal RNA
    4. Enterobacteriaceae bacterium ATCC 29904 5S rRNA
    5. Enterobacter ludwigii 5S ribosomal RNA
    6. Erwinia amylovora NBRC 12687 = CFBP 1232 5S ribosomal RNA
    7. Erwinia billingiae 5S rRNA
    8. Erwinia pyrifoliae 5S rRNA
    9. Erwinia pyrifoliae Ep1/96 5S ribosomal RNA
    10. Erwinia sp. Ejp617 5S rRNA
    11. Erwinia tasmaniensis 5S rRNA
    2D structure New