5S ribosomal RNA from Leishmania donovani (PDB 3JCS, chain 8)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5S ribosomal RNA from Leishmania donovani (PDB 3JCS, chain 8) URS000001EA06_5661

121 nucleotides
1 database (PDBe)
Found in 1 other species
3 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCGAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACUCACAGGCUCAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Leishmania braziliensis MHOM/BR/75/M2904 5S ribosomal RNA (M5)

Publications