Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-187 precursor URS000001D1A1_9545

Automated summary: This pre miRNA sequence is 109 nucleotides long and is found in Macaca nemestrina. Annotated by 3 databases (ENA, Ensembl, miRBase). Matches 1 Rfam family (mir-187, RF00674). Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-187 precursor sequence is a product of ENSMNEG00000024185.1 gene. Found in the pig-tailed macaque reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGUCAGGCUCACUAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGUGCUGCUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Macaca fascicularis miRNA
    2. Macaca mulatta (Rhesus monkey) microRNA mml-mir-187 precursor