Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-135b-5p URS000001C659_10141

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Cavia porcellus. Annotated by 2 databases (miRBase, MirGeneDB). Found in the Cavia porcellus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAUGGCUUUUCAUUCCUAUGUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Bos taurus bta-miR-135b
    2. Canis lupus familiaris cfa-miR-135b
    3. Capra hircus (goat) chi-miR-135b-5p
    4. Dasypus novemcinctus dno-miR-135b-5p
    5. Echinops telfairi Ete-Mir-135-P4_5p (mature (guide))
    6. Equus caballus (horse) eca-miR-135b
    7. Gorilla gorilla (western gorilla) ggo-miR-135b
    8. Homo sapiens hsa-miR-135b-5p
    9. Macaca mulatta mml-miR-135b-5p
    10. Monodelphis domestica Mdo-Mir-135-P4_5p (mature (guide))
    11. Mus musculus mmu-miR-135b-5p
    12. Oryctolagus cuniculus (rabbit) ocu-miR-135b-5p
    13. Pan troglodytes (chimpanzee) ptr-miR-135b
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-135b
    15. Rattus norvegicus (Norway rat) rno-miR-135b-5p
    16. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-135-P4_5p (mature (guide))
    17. Tupaia chinensis (Chinese tree shrew) tch-miR-135b-5p