Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-135b-5p URS000001C659_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-135b: Mmu-mir-135b is a miRNA located on mouse chromosome 1, with a primary transcript length of approximately 15 kb and 5' and 3' ends located around 7-8 kb upstream and downstream of the miRNA [PMC2238936]. It is expressed on day 3 but not on day 5, unlike mmu-miR-21 and mmu-miR-291-3p which maintain the same targets from day 3 to day 5 [PMC9149258]. Mmu-mir-135b is one of the five miRNAs that participate in both early and late stages, along with mmu-mir-200a, mmu-mir-200b, mmu-mir-494, and mmu-mir-503 [PMC3866260]. It is associated with HOXA4 and two joint target genes [PMC7074395]. However, further investigation is needed for genes such as mmu-miR-342, mmu-miR-135a, mmu-miR-206, and mmu-miR144 in mouse thymus as their studies have not been reported yet [PMC7074395]. Mmu-mir-135b is associated with PBX1 and three other DEMs in addition to five joint target genes [PMC7074395]. It has been found to be increased in the ventral midbrain but not significantly [PMC3861205]. The mirBridge approach has shown that Mmu-mir135b regulates the transforming growth factor-beta (TGF-beta) signaling pathway [PMC4077261].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGCUUUUCAUUCCUAUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Bos taurus (cattle) bta-miR-135b
  2. Canis lupus familiaris cfa-miR-135b
  3. Capra hircus (goat) chi-miR-135b-5p
  4. Cavia porcellus cpo-miR-135b-5p
  5. Dasypus novemcinctus dno-miR-135b-5p
  6. Echinops telfairi Ete-Mir-135-P4_5p (mature (guide))
  7. Equus caballus eca-miR-135b
  8. Gorilla gorilla gorilla ggo-miR-135b (MIR135B)
  9. Gorilla gorilla ggo-miR-135b
  10. Homo sapiens (human) hsa-miR-135b-5p
  11. Macaca mulatta (Rhesus monkey) mml-miR-135b-5p
  12. Monodelphis domestica Mdo-Mir-135-P4_5p (mature (guide))
  13. Oryctolagus cuniculus ocu-miR-135b-5p
  14. Pan troglodytes ptr-miR-135b
  15. Pongo pygmaeus ppy-miR-135b
  16. Rattus norvegicus (Norway rat) rno-miR-135b-5p
  17. Sarcophilus harrisii Sha-Mir-135-P4_5p (mature (guide))
  18. Tupaia chinensis tch-miR-135b-5p
Publications