Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-198 precursor secondary structure diagram

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-198 precursor URS000001B1C8_9597

Automated summary: This pre miRNA sequence is 62 nucleotides long and is found in Pan paniscus. Annotated by 3 databases (ENA, miRBase, RefSeq). Described in 3 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-198, RF00681). Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-198 precursor sequence is a product of MIR198, 198, mir-198 genes. Found in the pygmy chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUGUAGAAUAAAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Chlorocebus sabaeus microRNA mir-198
    2. Nomascus leucogenys microRNA mir-198
    3. Pan troglodytes microRNA ptr-mir-198 precursor
    4. Pongo abelii microRNA mir-198
    5. Pongo pygmaeus microRNA ppy-mir-198 precursor
    2D structure New