Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nomascus leucogenys (Northern white-cheeked gibbon) mir-198 microRNA precursor family secondary structure diagram

Nomascus leucogenys (Northern white-cheeked gibbon) mir-198 microRNA precursor family URS000001B1C8_61853

Automated summary: This pre miRNA sequence is 62 nucleotides long and is found in Nomascus leucogenys. Annotated by 1 database (Rfam). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-198, RF00681). Nomascus leucogenys (Northern white-cheeked gibbon) mir-198 microRNA precursor family sequence is a product of 198 microRNA precursor famil, 198 microRNA precursor family, mir-198 microRNA precursor family genes. Found in the Nomascus leucogenys reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCAUUGGUCCAGAGGGGAGAUAGGUUCCUGUGAUUUUUCCUUCUUCUCUGUAGAAUAAAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species

    2D structure Publications New