Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 46 (SNORA46) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 46 (SNORA46) URS0000018549_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA46: SNORA46 is a small nucleolar RNA (snoRNA) that is identified in bovine and human species [PMC7072903]. SNORA46 has been found to be highly expressed in grade I tumors compared to grade II/III tumors in meningioma [PMC8797451]. Its expression decreases from the beginning to the late stage of endometrial secretion [PMC8221328]. SNORA46, along with SNORA48, has been identified as a downregulated candidate gene linked to meningioma progression [PMC6489307]. It is expressed at significantly higher levels in grade I meningiomas compared to grades II and III [PMC6489307]. The higher levels of SNORA46 found in low-grade meningiomas suggest its role as a tumor progression suppressor [PMC6489307]. Additionally, SNORA46 has been found to be downregulated in chondrocytes and differentially expressed between grade I and grade II/III meningiomas [PMC7461137] [PMC6510770] [PMC7484374]. It is predicted to guide the modification of uridine (U469) in ribosomal 18S rRNA and has been associated with systemic sclerosis in patients with auto-antibodies to SNORD15 [PMC7212295].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCACUAUAUUUAAACCUGUGGAUGGGAAUAUUCCCCAUUCUUGGUUACGCUGUAGUGCAAAAGAAUUCCUGGCUCUCUGUUGCACAGCUGACUUGUGCCAUUCUGCUGUUGCUGUAUAGAGUUAAGGAACAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications