Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Hyphomicrobium sp. (drinking water metagenome) 5S ribosomal RNA secondary structure diagram

Hyphomicrobium sp. (drinking water metagenome) 5S ribosomal RNA URS000001610A_82

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGGUGAUUAUGGCGGGGUGGCUGCACCCGAUCCCAUUCCGAACUCGGCCGUGAAACGCCCCUGCGCCGAUGGUACUUCGUCUUAAGACGCGGGAGAGUAGGUCGUUGCCAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Hyphomicrobium denitrificans 5S rRNA
  2. Hyphomicrobium denitrificans ATCC 51888 5S ribosomal RNA
  3. Hyphomicrobium facile 5S rRNA. Bacterial TSU
  4. Hyphomicrobium sp. MC1 5S rRNA
  5. Sphingopyxis sp. 5S ribosomal RNA
2D structure