Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Hyphomicrobium sp. MC1 5S rRNA secondary structure diagram

Hyphomicrobium sp. MC1 5S rRNA URS000001610A_717785

Automated summary: This rRNA sequence is 115 nucleotides long and is found in Hyphomicrobium sp. MC1. Annotated by 2 databases (Rfam, 5SrRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCUGGUGAUUAUGGCGGGGUGGCUGCACCCGAUCCCAUUCCGAACUCGGCCGUGAAACGCCCCUGCGCCGAUGGUACUUCGUCUUAAGACGCGGGAGAGUAGGUCGUUGCCAGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 4 other species

    1. Hyphomicrobium denitrificans 5S rRNA
    2. Hyphomicrobium denitrificans ATCC 51888 5S ribosomal RNA
    3. Hyphomicrobium facile 5S rRNA. Bacterial TSU
    4. Hyphomicrobium sp. (drinking water metagenome) 5S ribosomal RNA
    2D structure