v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Let-7-P1a_3p* (star (passenger)) URS00000157F5_9913

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 13 other species
  • miRNA

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    CUGUACAGCCUCCUAGCUUUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Alligator mississippiensis ami-let-7c-2-3p
    2. Anolis carolinensis aca-let-7c-2-3p
    3. Canis lupus familiaris Cfa-Let-7-P1a_3p* (star (passenger))
    4. Cavia porcellus (domestic guinea pig) cpo-let-7a-2-3p
    5. Chrysemys picta bellii Cpi-Let-7-P1b_3p* (star (passenger))
    6. Chrysemys picta cpi-let-7c-2-3p
    7. Cricetulus griseus (Chinese hamster) cgr-let-7a-2
    8. Danio rerio (zebrafish) Dre-Let-7-P1a2_3p* (star (passenger))
    9. Dasypus novemcinctus dno-let-7c-2-3p
    10. Echinops telfairi (small Madagascar hedgehog) Ete-Let-7-P1a_3p* (star (passenger))
    11. Homo sapiens hsa-let-7a-2-3p
    12. Macaca mulatta mml-let-7a-2-3p
    13. Monodelphis domestica mdo-let-7a-3p
    14. Mus musculus (house mouse) Mmu-Let-7-P1a_3p* (star (passenger))
    15. Ophiophagus hannah oha-let-7c-1-3p
    16. Ornithorhynchus anatinus Oan-Let-7-P1a_3p* (star (passenger))
    17. Pteropus alecto pal-let-7a-2-3p
    18. Rattus norvegicus (Norway rat) rno-let-7a-2-3p
    19. Salmo salar ssa-let-7a-3p
    20. Sarcophilus harrisii Sha-Let-7-P1a_3p* (star (passenger))