Danio rerio (zebrafish) dre-miR-212 URS0000012002_7955

• 21 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 19 other species
• 69 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAACAGUCUACAGUCAUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

1. Callorhinchus milii eshark_mir-132_1
2. Gadus morhua (Atlantic cod) gmo-miR-212-3p
3. Gallus gallus gga-miR-212-3p
4. Gekko japonicus Gja-Mir-132-P2_3p (mature (co-guide))
5. Maylandia zebra mze-miR-212a
6. Oreochromis niloticus oni-miR-212b
7. Pundamilia nyererei pny-miR-212
8. Salmo salar (Atlantic salmon) ssa-miR-212b-3p
9. Takifugu rubripes (torafugu) fru-miR-212
10. Tetraodon nigroviridis tni-miR-212
11. Tor tambroides miR-212
12. Xenopus tropicalis xtr-miR-212

Publications Download

• FASTA
• JSON