Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-212 URS0000012002_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACAGUCUACAGUCAUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callorhinchus milii eshark_mir-132_1
  2. Danio rerio (zebrafish) dre-miR-212
  3. Gadus morhua gmo-miR-212-3p
  4. Gallus gallus (chicken) gga-miR-212-3p
  5. Gekko japonicus Gja-Mir-132-P2_3p (mature (co-guide))
  6. Maylandia zebra mze-miR-212a
  7. Oreochromis niloticus oni-miR-212a-3p
  8. Salmo salar ssa-miR-212b-3p
  9. Takifugu rubripes fru-miR-212
  10. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-212
  11. Tor tambroides (Thai mahseer) miR-212
  12. Xenopus tropicalis (tropical clawed frog) xtr-miR-212