v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-146-P1_5p (mature (guide)) URS00000114BC_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAGAACUGAAUUCCAUAGGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Bos taurus (cattle) bta-miR-146b
  2. Callithrix jacchus cja-miR-146b
  3. Canis lupus familiaris (dog) Cfa-Mir-146-P1_5p (mature (guide))
  4. Capra hircus (goat) chi-miR-146b-5p
  5. Cervus elaphus cel-miR-146b
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-146b-5p
  7. Drosophila erecta Drosophila_erecta piRNA piR-der-736299
  8. Drosophila melanogaster Drosophila_melanogaster piRNA piR-dme-21310294
  9. Gallus gallus Gallus_gallus piRNA piR-gga-63814
  10. Gorilla gorilla gorilla ggo-miR-146b (MIR146B)
  11. Gorilla gorilla (western gorilla) ggo-miR-146b
  12. Homo sapiens Hsa-Mir-146-P1_5p (mature (guide))
  13. Macaca mulatta Mml-Mir-146-P1_5p (mature (guide))
  14. Microcebus murinus (gray mouse lemur) mmr-miR-146b
  15. Monodelphis domestica Mdo-Mir-146-P1_5p (mature (guide))
  16. Mus musculus (house mouse) Mmu-Mir-146-P1_5p (mature (guide))
  17. Nomascus leucogenys nle-miR-146b
  18. Ornithorhynchus anatinus Oan-Mir-146-P1_5p (mature (guide))
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-146b
  20. Papio hamadryas pha-miR-146b
  21. Petromyzon marinus (sea lamprey) Pma-Mir-146_5p (mature (guide))
  22. Pteropus alecto pal-miR-146b-5p
  23. Rattus norvegicus (Norway rat) rno-miR-146b-5p
  24. Saimiri boliviensis boliviensis sbo-miR-146b
  25. Sarcophilus harrisii Sha-Mir-146-P1_5p (mature (guide))
  26. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-601189