Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-320c URS0000010D30_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-320c: Hsa-mir-320c is a microRNA that has been found to be upregulated in plasma extracellular vesicles (EVs) in patients with progressive disease (PD) compared to those with partial response (PR) [PMC8121992]. The levels of hsa-mir-320c, along with hsa-miR-320d and hsa-miR-320b, were significantly higher in the PD group, indicating an unfavorable response of these microRNAs to immunotherapy [PMC8121992]. In a study using a cut-off at logCPM>4, p<0.05, and FDR≤0.1, hsa-miR-320d was identified as the most significant differentially expressed (DE) microRNA. Hsa-mir-320c was also found to be differentially expressed along with hsa-miR-642a-3p and hsa-miR-320b, with FDR values around 0.1 [PMC7057418]. These findings suggest that hsa-mir-320c may play a role in disease progression and could potentially serve as a biomarker for monitoring response to immunotherapy [PMC8121992][PMC7057418]. Further research is needed to fully understand the functional significance of hsa-mir-320c and its potential implications in PD and immunotherapy response.

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications