Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-26 URS000000E09E_8267

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) microRNA miR-26a
  2. Capra hircus (goat) miR-26a
  3. Gallus gallus gga-miR-26a-5p
  4. Monodelphis domestica mdo-miR-26-5p
  5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72537
  6. Oryzias latipes (Japanese medaka) ola-miR-26
  7. Ovis aries (sheep) miscellaneous RNA
  8. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63023
  9. Tursiops truncatus miR-26a
  10. Xenopus tropicalis xtr-miR-26