v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63023 URS000000E09E_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCAAGUAAUCCAGGAUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Bos taurus (cattle) microRNA miR-26a
  2. Capra hircus (goat) miR-26a
  3. Gallus gallus gga-miR-26a-5p
  4. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-26
  5. Monodelphis domestica mdo-miR-26-5p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72537
  7. Oryzias latipes (Japanese medaka) ola-miR-26
  8. Ovis aries (sheep) miscellaneous RNA
  9. Tursiops truncatus miR-26a
  10. Xenopus tropicalis xtr-miR-26