Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-152-5p URS000000C73C_9860

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Cervus elaphus. Annotated by 1 database (ENA). Cervus elaphus (red deer) cel-miR-152-5p sequence is a product of miR-152, cel-miR-152, miR-152-5p, cel-miR-152-5p genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGUUCUGUGAUACACUCCGACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 59 other species

    1. Bos taurus (cattle) Bta-Mir-148-P2_5p* (star (passenger))
    2. Canis lupus familiaris Cfa-Mir-148-P2_5p* (star (passenger))
    3. Cricetulus griseus cgr-miR-152-5p
    4. Homo sapiens (human) hsa-miR-152-5p
    5. Macaca mulatta mml-miR-152-5p
    6. Monodelphis domestica mdo-miR-152-5p
    7. Mus musculus Mus_musculus piRNA piR-mmu-50281734
    8. Oryctolagus cuniculus (rabbit) ocu-miR-152-5p
    9. Pteropus alecto (black flying fox) pal-miR-152-5p
    10. Rattus norvegicus rno-miR-152-5p