Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-152-5p URS000000C73C_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUUCUGUGAUACACUCCGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cervus elaphus cel-miR-152-5p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-152-5p
  3. Homo sapiens hsa-miR-152-5p
  4. Macaca mulatta mml-miR-152-5p
  5. Monodelphis domestica mdo-miR-152-5p
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-50281734
  7. Oryctolagus cuniculus ocu-miR-152-5p
  8. Pteropus alecto pal-miR-152-5p
Publications