Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhizobium phaseoli Ch24-10 5S ribosomal RNA secondary structure diagram

Rhizobium phaseoli Ch24-10 5S ribosomal RNA URS000000C052_1128399

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCUGGUGGUUAUGGCGGGGUGGCUGCACCCGUUCCCUUUCCGAACACGGCCGUGAAACGCCCCUGCGCCCAUGGUACUUCGUCUUAAGACGCGGGAGAGUAGGUCGCUGCCAGGUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Rhizobium etli 5S rRNA
  2. Rhizobium etli bv. mimosae str. Mim1 5S ribosomal RNA
  3. Rhizobium etli bv. phaseoli str. IE4803 5S ribosomal RNA
  4. Rhizobium etli CFN 42 5S ribosomal RNA
  5. Rhizobium etli CIAT 652 5S ribosomal RNA
2D structure