Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anaeromyxobacter sp. K 5S rRNA secondary structure diagram

Anaeromyxobacter sp. K 5S rRNA URS000000BC22_447217

Automated summary: This rRNA sequence is 117 nucleotides long and is found in Anaeromyxobacter sp. K. Annotated by 1 database (5SrRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGCGGUGGCUAUAUCGGUGGGGUCACACCCGUUCCCAUCCCGAACACGGUAGUUAAGCCCACCAGAGCCGAUGGUACUGCACCGGAAGCGGUGUGGGAGAGUAGGUCGCUGCCGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Anaeromyxobacter dehalogenans 2CP-C 5S ribosomal RNA
    2. Anaeromyxobacter dehalogenans 5S rRNA
    2D structure