Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7e-5p URS000000B1C9_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, TarBase, miRBase, MirGeneDB, RefSeq, LncBase, ENA). Mus musculus (house mouse) mmu-let-7e-5p sequence is a product of let-7e, mmu-let-7e, let-7, let-7e-5p, mmu-let-7e-5p, Mirlet7e genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007A03Rik, 0610007D13Rik, 0610009E22Rik, 0610010B06Rik, 0610010G05Rik, 0610011A13Rik, 0610011L13Rik, 0610012F07Rik, 0610012J02Rik, 0610013E23Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-let-7e-5p interacts with:

Interaction id Participant Synonyms
URS000000B1C9_10090-0 P41245 P41245
URS000000B1C9_10090-1 P41245 P41245

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAGGUAGGAGGUUGUAUAGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 22 other species

    1. Bos taurus (cattle) Bta-Let-7-P1b_5p (mature (guide))
    2. Callithrix jacchus cja-let-7e
    3. Canis lupus familiaris cfa-let-7e
    4. Capra hircus chi-let-7e-5p
    5. Cavia porcellus cpo-let-7e-5p
    6. Cervus elaphus (red deer) cel-let-7e
    7. Echinops telfairi Ete-Let-7-P1b_5p (mature (guide))
    8. Equus caballus (horse) eca-let-7e
    9. Homo sapiens hsa-let-7e-5p
    10. Macaca mulatta (Rhesus monkey) mml-let-7e-5p
    11. Nomascus leucogenys nle-let-7e
    12. Oryctolagus cuniculus Ocu-Let-7-P1b_5p (mature (guide))
    13. Otolemur garnettii (small-eared galago) oga-let-7e
    14. Pan paniscus ppa-let-7e
    15. Pan troglodytes ptr-let-7e
    16. Papio hamadryas (hamadryas baboon) pha-let-7e
    17. Pongo pygmaeus (Bornean orangutan) ppy-let-7e
    18. Pteropus alecto (black flying fox) pal-let-7e-5p
    19. Rattus norvegicus rno-let-7e-5p
    20. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-let-7e
    21. Sus scrofa (pig) ssc-let-7e
    22. Tupaia chinensis (Chinese tree shrew) tch-let-7e-5p
    Publications New