Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 4 (SNORA4) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 4 (SNORA4) URS000000AB5A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA4: SNORA4 is a small nucleolar RNA (snoRNA) that has been found to be decreased in the learning group [PMC7164515]. It has been observed that snoRNAs, including SNORA4, can undergo adenylation, resulting in the addition of adenine residues [PMC8583065]. This adenylation has been detected in various snoRNAs, including SNORA4 and SNORD86 [PMC8583065]. In Xenopus, SNORA4 has been identified to have antisense elements that position a conserved pseudouridine in 28S rRNA [PMC6984369]. In the context of influenza A infection, it has been found that SNORA4 is significantly down-regulated in response to seasonal H1N1 infection but not pdmH1N1 infection [PMC2988725]. This suggests that seasonal H1N1 virus may be more efficient at suppressing host translational mechanisms and allowing for efficient translation of viral mRNA [PMC2988725]. Additionally, it has been noted that EIF3A contains a single copy of SNORA19 and EIF4A2 introns contain several snoRNAs including SNORA4 and SNORD2 [PMC8759569].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCAAAAGUUAGCUUUUUGGGGGGCAGGUUUUUAAGUAACCUUUGCCAACUUGGGCUAUUUGGAAGAGUAAAAGACCACACUCCACAGUGGGCUAUACCACUUAGUAUAGUUCGCUACUAUUUUGUGGCCUACAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications