Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-143 precursor URS0000008A99_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR143: MIR143 is a microRNA that has been studied in the context of obesity and ovarian function [PMC9687157]. In a study, it was found that the levels of MIR143 were negatively correlated with the mRNA levels of inflammatory cytokines IL1β, IL6, and TNFα in the ovaries of obese individuals [PMC9687157]. This suggests that MIR143 may play a role in regulating inflammation in obese individuals. Additionally, over-expression of MIR143 led to decreased expression of predicted target proteins HK2 and ADRB1, as well as a reduced Bcl-2/Bax ratio [PMC5735881]. This indicates that MIR143 may also be involved in regulating cellular metabolism and apoptosis. These findings highlight the potential importance of MIR143 in obesity-related ovarian dysfunction and provide insights into its molecular mechanisms [PMC9687157] [PMC5735881]. Further research is needed to fully understand the role of MIR143 in these processes and its potential as a therapeutic target for obesity-related disorders [PMC9687157] [PMC5735881].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications