Gorilla gorilla (western gorilla) microRNA ggo-mir-143 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) microRNA ggo-mir-143 precursor URS0000008A99_9593

106 nucleotides
2 databases (ENA, miRBase)
Found in 11 other species
2 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-143 (ENSGGOG00000034713.2)
Homo sapiens microRNA hsa-mir-143 precursor
Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-143 precursor
Piliocolobus tephrosceles microRNA 143 (ENSPTEG00000020691.1)
Pongo abelii (Sumatran orangutan) microRNA 143 (ENSPPYG00000022126.2)
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-143 precursor
Rhinopithecus bieti (Black snub-nosed monkey) microRNA 143 (ENSRBIG00000007149.1)
Rhinopithecus roxellana microRNA 143 (ENSRROG00000002138.1)

Publications