Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA, variant U1 small nuclear 7 (RNVU1-7) secondary structure diagram

Homo sapiens (human) RNA, variant U1 small nuclear 7 (RNVU1-7) URS00000081EA_9606

Automated summary: This snRNA sequence is 164 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (Rfam, ENA, RefSeq, GeneCards, Ensembl, HGNC). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (U1, RF00003). Homo sapiens (human) RNA, variant U1 small nuclear 7 (RNVU1-7) sequence is a product of RNVU1-7, ENSG00000206585.1 genes. Found in the Homo sapiens reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUACUUACCUGGCAGGGGAGAUACCAUGAUCACGAAGGUGGUUUUCCCAGGGCGAGGCUUAUCCAUUGCACUCCGGAUGUGCUGACCCCUGCGAUUUCCCCAAAUGUGGGAAACUCGACUGCAUAAUUUGUGGUAGUGGGGGACUGCGUCCGCGCUUUCCCCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications